CD160, also known as Natural killer cell receptor BY55, is a GPI-anchored cell surface protein. As a member of the Ig (immunoglobulin) superfamily, CD160 contains 1 Ig-like V-type domain in its extracellular region. Its expression is restricted to functional NK and T cytotoxic lymphocytes. CD160 is expressed as a disulfide-linked multimer on the cell surface. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is known to bind HLA-G1, HLA-C, and HVEM. CD160 binding to HLA-G1 initiates apoptosis. CD160 signaling in response to HLA-C binding promotes cytokine secretion. CD160 is up regulated on CD4+ T cells following activation. CD160 may function as a co-activator receptor for CD3-induced proliferation of T cells and CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. CD160 engagement by HVEM (expressed by APC) serves to block a simultaneous LIGHT stimulation of HVEM that promotes receptor expression and cytokine release. Activated NK lymphocytes may release a soluble form of CD160 that impairs the MHC-I-specific cytotoxic T lymphocyte responsiveness.

 

CD160, also known as Natural killer cell receptor BY55, is a GPI-anchored cell surface protein. As a member of the Ig (immunoglobulin) superfamily, CD160 contains 1 Ig-like V-type domain in its extracellular region. Its expression is restricted to functional NK and T cytotoxic lymphocytes. CD160 is expressed as a disulfide-linked multimer on the cell surface. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is known to bind HLA-G1, HLA-C, and HVEM. CD160 binding to HLA-G1 initiates apoptosis. CD160 signaling in response to HLA-C binding promotes cytokine secretion. CD160 is up regulated on CD4+ T cells following activation. CD160 may function as a co-activator receptor for CD3-induced proliferation of T cells and CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. CD160 engagement by HVEM (expressed by APC) serves to block a simultaneous LIGHT stimulation of HVEM that promotes receptor expression and cytokine release. Activated NK lymphocytes may release a soluble form of CD160 that impairs the MHC-I-specific cytotoxic T lymphocyte responsiveness.

  

Product Details

 

Gene Symbol: CD160; NK1; BY55; NK28

  

NCBI Gene ID: 11126

 

Uniprot Entry: O95971

 

Construct Details: Full length human CD160 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGCTGTTGGAACCCGGCAGAGGCTGCTGTGCCCTGGCCATCCTGCTGGCAATTGTGGACATCCAGTCTG

GTGGATGCATTAACATCACCAGCTCAGCTTCCCAGGAAGGAACGCGACTAAACTTAATCTGTACTGTATG

GCATAAGAAAGAAGAGGCTGAGGGGTTTGTAGTGTTTTTGTGCAAGGACAGGTCTGGAGACTGTTCTCCT

GAGACCAGTTTAAAACAGCTGAGACTTAAAAGGGATCCTGGGATAGATGGTGTTGGTGAAATATCATCTC

AGTTGATGTTCACCATAAGCCAAGTCACACCGTTGCACAGTGGGACCTACCAGTGTTGTGCCAGAAGCCA

GAAGTCAGGTATCCGCCTTCAGGGCCATTTTTTCTCCATTCTATTCACAGAGACAGGGAACTACACAGTG

ACGGGATTGAAACAAAGACAACACCTTGAGTTCAGCCATAATGAAGGCACTCTCAGTTCAGGCTTCCTAC

AAGAAAAGGTCTGGGTAATGCTGGTCACCAGCCTTGTGGCCCTTCAAGCTTTGTAA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

1. J. Immunol. 161:2780 (1998)

2. J. Immunol. 162:1223 (1999)

3. J Immunol.173: 5349 (2004)

4. Immunol. Rev. 229:244 (2009)

 

 

  

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.