Cytotoxic T-lymphocyte antigen 4 (CTLA4), aslo known as CD152, is a single pass type I transmembrane glycoprotein of the Ig superfamily. It is composed of an IgV-type extracellular domain, a transmembrane domain, and a cytoplasmic tail.  CTLA4 is the founding member of the CD28/CTLA-4 family. Members of the CD28/CTLA-4 family either promote T cell activation (CD28 and ICOS) or inhibit T cell activation (CTLA4 and PD­1).  Both CTLA-4 and CD28 bind to the same B7 family ligands, CD80/B7-1 and CD86/B7-2.  CTLA-4 binds to B7-1 and B7-2 with a 20-100 fold higher affinity than CD28.  The CTLA4 gene is widely expressed with highest levels in lymphoid tissues.  It is detected in activated T-cells where expression levels are 30- to 50-fold less than CD28 on the cell surface following activation. Mutations in CTLA4 gene is associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases.  Alternate transcriptional splice variants, encoding different isoforms of CTLA4, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. The engineered CTLA4-Fc fusion proteins inhibit T-cell-dependent immune responses and are used as immunosuppressive agents by acting as a competitive inhibitor of CD28. Blockade of CTLA4 inhibitory activity with monoclonal antibodies enhances antitumor immunity and has been proven to be an effective approach for cancer immunotherapy. 

Cytotoxic T-lymphocyte antigen 4 (CTLA4), aslo known as CD152, is a single pass type I transmembrane glycoprotein of the Ig superfamily. It is composed of an IgV-type extracellular domain, a transmembrane domain, and a cytoplasmic tail.  CTLA4 is the founding member of the CD28/CTLA-4 family. Members of the CD28/CTLA-4 family either promote T cell activation (CD28 and ICOS) or inhibit T cell activation (CTLA4 and PD­1).  Both CTLA-4 and CD28 bind to the same B7 family ligands, CD80/B7-1 and CD86/B7-2.  CTLA-4 binds to B7-1 and B7-2 with a 20-100 fold higher affinity than CD28.  The CTLA4 gene is widely expressed with highest levels in lymphoid tissues.  It is detected in activated T-cells where expression levels are 30- to 50-fold less than CD28 on the cell surface following activation. Mutations in CTLA4 gene is associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases.  Alternate transcriptional splice variants, encoding different isoforms of CTLA4, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. The engineered CTLA4-Fc fusion proteins inhibit T-cell-dependent immune responses and are used as immunosuppressive agents by acting as a competitive inhibitor of CD28. Blockade of CTLA4 inhibitory activity with monoclonal antibodies enhances antitumor immunity and has been proven to be an effective approach for cancer immunotherapy. 

 

Product Details

 

Gene Symbol: CTLA4; CD152; CD; GSE; GRD4; CTLA-4; IDDM12; CELIAC3

 

NCBI Gene ID: 12477

 

Uniprot Entry: P09793

 

Construct Details: Full length mouse CTLA4 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter -/+ an antibiotics selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple selection markers are available.

 

Vector Type: pLTC or pLTC-marker (lentiviral expression vector containing a heterologous CMV promoter +/- marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 672 (bp)

 

Gene Insert Sequence:  

ATGGCTTGTCTTGGACTCCGGAGGTACAAAGCTCAACTGCAGCTGCCTTCTAGGACTTGGCCTTTTGTAG

CCCTGCTCACTCTTCTTTTCATCCCAGTCTTCTCTGAAGCCATACAGGTGACCCAACCTTCAGTGGTGTT

GGCTAGCAGCCATGGTGTCGCCAGCTTTCCATGTGAATATTCACCATCACACAACACTGATGAGGTCCGG

GTGACTGTGCTGCGGCAGACAAATGACCAAATGACTGAGGTCTGTGCCACGACATTCACAGAGAAGAATA

CAGTGGGCTTCCTAGATTACCCCTTCTGCAGTGGTACCTTTAATGAAAGCAGAGTGAACCTCACCATCCA

AGGACTGAGAGCTGTTGACACGGGACTGTACCTCTGCAAGGTGGAACTCATGTACCCACCGCCATACTTT

GTGGGCATGGGCAACGGGACGCAGATTTATGTCATTGATCCAGAACCATGCCCGGATTCTGACTTCCTCC

TTTGGATCCTTGTCGCAGTTAGCTTGGGGTTGTTTTTTTACAGTTTCCTGGTCACTGCTGTTTCTTTGAG

CAAGATGCTAAAGAAAAGAAGTCCTCTTACAACAGGGGTCTATGTGAAAATGCCCCCAACAGAGCCAGAA

TGTGAAAAGCAATTTCAGCCTTATTTTATTCCCATCAACTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Eur. J. Immunol. 18:1901-1905 (1988)

2. J. Exp. Med. 174:561-569 (1991)

3. Annu. Rev. Immunol. 24:65-97 (2006)

4. Immunol. Rev. 229:307-321 (2009) 

 

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.