CD20, also known as MS4A1, Bp35, CVID5 and LEU-16, is 4-pass transmembrane protein belonging to the MS4A (membrane-spanning 4-domains subfamily A) family. Members of this protein family are characterized by common genomic and protein structural features as well as unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 is expressed on all stages of B cell development except pro-B cells or plasma cells. CD20 may be involved in the regulation of B-cell activation and proliferation. Mutations in the CD20 gene are associated with immunodeficiency common variable type 5 (CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The deficiency may result from a failure of B-cell differentiation and impaired secretion of immunoglobulins despite that the numbers of circulating B-cells is usually in the normal range. Monoclonal antibodies (mAb) against CD20 (e.g., Rituximab) are used to treat B-cell non-Hodgkin lymphoma (NHL) and B cell leukemia as well as inflammatory diseases such as rheumatoid arthritis (RA). CD20 engaged by mAb can generate signals capable of directly controlling cell growth and triggering cell death in certain tumors. Alternatively, mAb may mediate complement-dependent cytotoxicity, leading to a rapid depletion of CD20-expressing B cells.

CD20, also known as MS4A1, Bp35, CVID5 and LEU-16, is 4-pass transmembrane protein belonging to the MS4A (membrane-spanning 4-domains subfamily A) family. Members of this protein family are characterized by common genomic and protein structural features as well as unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 is expressed on all stages of B cell development except pro-B cells or plasma cells. CD20 may be involved in the regulation of B-cell activation and proliferation. Mutations in the CD20 gene are associated with immunodeficiency common variable type 5 (CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The deficiency may result from a failure of B-cell differentiation and impaired secretion of immunoglobulins despite that the numbers of circulating B-cells is usually in the normal range. Monoclonal antibodies (mAb) against CD20 (e.g., Rituximab) are used to treat B-cell non-Hodgkin lymphoma (NHL) and B cell leukemia as well as inflammatory diseases such as rheumatoid arthritis (RA). CD20 engaged by mAb can generate signals capable of directly controlling cell growth and triggering cell death in certain tumors. Alternatively, mAb may mediate complement-dependent cytotoxicity, leading to a rapid depletion of CD20-expressing B cells.

 

Product Details

 

Gene Symbol: CD20; B1; S7; Bp35; CVID5; MS4A1; LEU-16

 

NCBI Gene ID: 931

 

Uniprot Entry: P11836

 

Construct Details: Full length human CD20 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGACAACACCCAGAAATTCAGTAAATGGGACTTTCCCGGCAGAGCCAATGAAAGGCCCTATTGCTATGCAATCTGGTCC

AAAACCACTCTTCAGGAGGATGTCTTCACTGGTGGGCCCCACGCAAAGCTTCTTCATGAGGGAATCTAAGACTTTGGGGG

CTGTCCAGATTATGAATGGGCTCTTCCACATTGCCCTGGGGGGTCTTCTGATGATCCCAGCAGGGATCTATGCACCCATC

TGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTCCTGGCAGCAACGGAGAAAAA

CTCCAGGAAGTGTTTGGTCAAAGGAAAAATGATAATGAATTCATTGAGCCTCTTTGCTGCCATTTCTGGAATGATTCTTT

CAATCATGGACATACTTAATATTAAAATTTCCCATTTTTTAAAAATGGAGAGTCTGAATTTTATTAGAGCTCACACACCA

TATATTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACCCAATACTGTTACAGCATACA

ATCTCTGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTTGCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGAGA

ATGAATGGAAAAGAACGTGCTCCAGACCCAAATCTAACATAGTTCTCCTGTCAGCAGAAGAAAAAAAAGAACAGACTATT

GAAATAAAAGAAGAAGTGGTTGGGCTAACTGAAACATCTTCCCAACCAAAGAATGAAGAAGACATTGAAATTATTCCAAT

CCAAGAAGAGGAAGAAGAAGAAACAGAGACGAACTTTCCAGAACCTCCCCAAGATCAGGAATCCTCACCAATAGAAAATG

ACAGCTCTCCTTAA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Proc. Natl. Acad. Sci. 85:208 (1988).

2. J. Immunol. 142:2560 (1989).

3. Leukemia. 17:1384 (2003).

4. J. Immunol. 177:362 (2006).

5. J. Clin. Invest. 120:214 (2010).

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0009-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.