ROR2 (receptor tyrosine kinase-like orphan receptor 2), also known as NTRKR2 (neurotrophic tyrosine kinase, receptor-related 2), is a single-pass type I transmembrane glycoprotein that belongs to the ROR subfamily of the tyrosine protein kinase family. The ROR subfamily members, ROR1 and ROR2, are tyrosine kinase receptors important in regulating skeletal and neuronal development, cell migration and cell polarity. Each ROR member contains 1 FZ (frizzled) domain, 1 Ig (immunoglobulin)-like C2-type domain, and 1 kringle domain in the extracellular region and 1 protein kinase domain in the cytoplasmic region. ROR2 is expressed at high levels during early embryonic development. The expression levels drop strongly around day 16 and there are only very low levels in adult tissues.  ROR2 may be involved in the early formation of the chondrocytes and required for cartilage and growth plate development. ROR2 exists as a homodimer on the cell surface and may mediate a signaling pathway that promotes osteogenesis and bone formation. Mutations in the ROR2 gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. ROR2 appears to possess dual roles as a tumor suppressor or activator depending on tumor type.

ROR2 (receptor tyrosine kinase-like orphan receptor 2), also known as NTRKR2 (neurotrophic tyrosine kinase, receptor-related 2), is a single-pass type I transmembrane glycoprotein that belongs to the ROR subfamily of the tyrosine protein kinase family. The ROR subfamily members, ROR1 and ROR2, are tyrosine kinase receptors important in regulating skeletal and neuronal development, cell migration and cell polarity. Each ROR member contains 1 FZ (frizzled) domain, 1 Ig (immunoglobulin)-like C2-type domain, and 1 kringle domain in the extracellular region and 1 protein kinase domain in the cytoplasmic region. ROR2 is expressed at high levels during early embryonic development. The expression levels drop strongly around day 16 and there are only very low levels in adult tissues.  ROR2 may be involved in the early formation of the chondrocytes and required for cartilage and growth plate development. ROR2 exists as a homodimer on the cell surface and may mediate a signaling pathway that promotes osteogenesis and bone formation. Mutations in the ROR2 gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. ROR2 appears to possess dual roles as a tumor suppressor or activator depending on tumor type.

 

Product Details

 

Gene Symbol: BDB; BDB1; NTRKR2

 

NCBI Gene ID: 4920

 

Uniprot Entry: Q01974

 

Construct Details: Full length human ROR2 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Gene Insert Sequence:  

ATGGCCCGGGGCTCGGCGCTCCCGCGGCGGCCGCTGCTGTGCATCCCGGCCGTCTGGGCGGCCGCCGCGCTTCTGCTCTC

AGTGTCCCGGACTTCAGGTGAAGTGGAGGTTCTGGATCCGAACGACCCTTTAGGACCCCTTGATGGGCAGGACGGCCCGA

TTCCAACTCTGAAAGGTTACTTTCTGAATTTTCTGGAGCCAGTAAACAATATCACCATTGTCCAAGGCCAGACGGCAATT

CTGCACTGCAAGGTGGCAGGAAACCCACCCCCTAACGTGCGGTGGCTAAAGAATGATGCCCCGGTGGTGCAGGAGCCGCG

GCGGATCATCATCCGGAAGACAGAATATGGTTCACGACTGCGAATCCAGGACCTGGACACGACAGACACTGGCTACTACC

AGTGCGTGGCCACCAACGGGATGAAGACCATTACCGCCACTGGCGTCCTGTTTGTGCGGCTGGGTCCAACGCACAGCCCA

AATCATAACTTTCAGGATGATTACCACGAGGATGGGTTCTGCCAGCCTTACCGGGGAATTGCCTGTGCACGCTTCATTGG

CAACCGGACCATTTATGTGGACTCGCTTCAGATGCAGGGGGAGATTGAAAACCGAATCACAGCGGCCTTCACCATGATCG

GCACGTCTACGCACCTGTCGGACCAGTGCTCACAGTTCGCCATCCCATCCTTCTGCCACTTCGTGTTTCCTCTGTGCGAC

GCGCGCTCCCGGACACCCAAGCCGCGTGAGCTGTGCCGCGACGAGTGCGAGGTGCTGGAGAGCGACCTGTGCCGCCAGGA

GTACACCATCGCCCGCTCCAACCCGCTCATCCTCATGCGGCTTCAGCTGCCCAAGTGTGAGGCGCTGCCCATGCCTGAGA

GCCCCGACGCTGCCAACTGCATGCGCATTGGCATCCCAGCCGAGAGGCTGGGCCGCTACCATCAGTGCTATAACGGCTCA

GGCATGGATTACAGAGGAACGGCAAGCACCACCAAGTCAGGCCACCAGTGCCAGCCGTGGGCCCTGCAGCACCCCCACAG

CCACCACCTGTCCAGCACAGACTTCCCTGAGCTTGGAGGGGGGCACGCCTACTGCCGGAACCCCGGAGGCCAGATGGAGG

GCCCCTGGTGCTTTACGCAGAATAAAAACGTACGCATGGAACTGTGTGACGTACCCTCGTGTAGTCCCCGAGACAGCAGC

AAGATGGGGATTCTGTACATCTTGGTCCCCAGCATCGCAATTCCACTGGTCATCGCTTGCCTTTTCTTCTTGGTTTGCAT

GTGCCGGAATAAGCAGAAGGCATCTGCGTCCACACCGCAGCGGCGACAGCTGATGGCCTCGCCCAGCCAAGACATGGAAA

TGCCCCTCATTAACCAGCACAAACAGGCCAAACTCAAAGAGATCAGCCTGTCTGCGGTGAGGTTCATGGAGGAGCTGGGA

GAGGACCGGTTTGGGAAAGTCTACAAAGGTCACCTGTTCGGCCCTGCCCCGGGGGAGCAGACCCAGGCTGTGGCCATCAA

AACGCTGAAGGACAAAGCGGAGGGGCCCCTGCGGGAGGAGTTCCGGCATGAGGCTATGCTGCGAGCACGGCTGCAACACC

CCAACGTCGTCTGCCTGCTGGGCGTGGTGACCAAGGACCAGCCCCTGAGCATGATCTTCAGCTACTGTTCGCACGGCGAC

CTCCACGAATTCCTGGTCATGCGCTCGCCGCACTCGGACGTGGGCAGCACCGATGATGACCGCACGGTGAAGTCCGCCCT

GGAGCCCCCCGACTTCGTGCACCTTGTGGCACAGATCGCGGCGGGGATGGAGTACCTATCCAGCCACCACGTGGTTCACA

AGGACCTGGCCACCCGCAATGTGCTAGTGTACGACAAGCTGAACGTGAAGATCTCAGACTTGGGCCTCTTCCGAGAGGTG

TATGCCGCCGATTACTACAAGCTGCTGGGGAACTCGCTGCTGCCTATCCGCTGGATGGCCCCAGAGGCCATCATGTACGG

CAAGTTCTCCATCGACTCAGACATCTGGTCCTACGGTGTGGTCCTGTGGGAGGTCTTCAGCTACGGCCTGCAGCCCTACT

GCGGGTACTCCAACCAGGATGTGGTGGAGATGATCCGGAACCGGCAGGTGCTGCCTTGCCCCGATGACTGTCCCGCCTGG

GTGTATGCCCTCATGATCGAGTGCTGGAACGAGTTCCCCAGCCGGCGGCCCCGCTTCAAGGACATCCACAGCCGGCTCCG

AGCCTGGGGCAACCTTTCCAACTACAACAGCTCGGCGCAGACCTCGGGGGCCAGCAACACCACGCAGACCAGCTCCCTGA

GCACCAGCCCAGTGAGCAATGTGAGCAACGCCCGCTACGTGGGGCCCAAGCAGAAGGCCCCGCCCTTCCCACAGCCCCAG

TTCATCCCCATGAAGGGCCAGATCAGACCCATGGTGCCCCCGCCGCAGCTCTACGTCCCCGTCAACGGCTACCAGCCGGT

GCCGGCCTATGGGGCCTACCTGCCCAACTTCTACCCGGTGCAGATCCCAATGCAGATGGCCCCGCAGCAGGTGCCTCCTC

AGATGGTCCCCAAGCCCAGCTCACACCACAGTGGCAGTGGCTCCACCAGCACAGGCTACGTCACCACGGCCCCCTCCAAC

ACATCCATGGCAGACAGGGCAGCCCTGCTCTCAGAGGGCGCTGATGACACACAGAACGCCCCAGAAGATGGGGCCCAGAG

CACCGTGCAGGAAGCAGAGGAGGAGGAGGAAGGCTCTGTCCCAGAGACTGAGCTGCTGGGGGACTGTGACACTCTGCAGG

TGGACGAGGCCCAAGTCCAGCTGGAAGCTTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Formulation: Lentivector encoded and pre-packaged viral particles (typical titer 10⁶ - 10⁷ IFU/ml) in the conditional medium (serum-free) from HEK293 cells that have been transfected with the lentivector gene clone and the LentiPAK DNA mix

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Important Safety Information: With the safety features in place, our lentiviral vectors and viral particles can be employed in standard Biosafety Level 2 tissue culture facilities and should be treated with the same level of caution as any other potentially infectious agent. Any investigator who purchases our lentiviral/retroviral products & services is responsible for following Biosafety Level 2 requirements on the handling of viral particles. For more information on Biosafety Level 2 agents and practices, please refer to NIH’s “Biosafety Considerations for Research with Lentiviral Vectors”.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Transduction Protocol

 

Pre-packaged lentiviral particles are most advanced gene delivery tools. Each particles contain a fully sequence verified target gene and are psudotyped with the VSV-G glycoprotein, ready for transduction into into a wide range of cell types including hard-to-transfect primary cells and non-dividing cells. They are supplied in 1-mL aliquot(s) of the serum-/antibiotic-free solution suitable for both in vitro and in vivo delivery. They are produced in HEK293 packaging cells with a typical titer of ≥10⁷ IFU/ml using our optimized LentPAK^TM packaging system. The lentiviral particles can be used to transduce subconfluent target cells. Depending on your purpose, you may choose a specific multiplicity of infection (MOI) or test a range of MOIs to determine which gives you the desired results. Transduction can be enhanced by the addition of polybrene, also known as hexadimethrine bromide (typically at 8-10 μg/ml). 

 

Quick Protocol for Transduction

 

Day 1. Seeding Target Cells

For an example, plate target cells in a 10 cm plate at a density of 1 - 5x 10⁵ cells/ml that will produce approximately 60% confluency in 24 hours.

 

Note: other size plates can also be used depending on the nature of your experiment. Adjust the reagent amount according to Table 1

 

Table 1. Seeding Density of Target Cells (1 day prior to transduction)

Vessel Type	Seeding Density	Volume of Media
10-cm dish	1 – 5 x 106	10 mL
6-well plate	0.3 – 1 x 106	2 mL/well
12-well plate	0.15 – 0.5 x 106	1 mL/well
24-well plate	0.6 – 2 x 105	0.5 mL/well
96-well plate	1 – 4 x 104	0.1 mL/well

  

Day 2. Transduction

Remove the growth media from the dish/plate prepared the day before. Replace with 1/2 volume of culture medium containing desired amount of lentiviral particles (at 2 to 20 MOI).  For example, add 4.5 mL of growth medium and 0.5 mL of Lentiviral particles, or simply add 5 mL of Lentiviral particles (for a low titer viral preparation or a high MOI transduction). Add polybrene directly to the media on the target cells at 8 μg/ml. Mix by gentle swirling.

 

Incubate at 37°C with 5% CO2 for 4 - 24 hours, then replace the transduction medium with right amount of growth medium according to table 1 (for example 10 mL for 10-cm dish). Culture the cells for 48 – 72 hours, and transduced cells are ready for downstream analyses.

 

Note: Adjust volumes accordingly for transduction of other plate types.  For example, add 1 ml of growth medium and lentiviral particle mixture for 6-well plate, 0.5 ml for 12-well and 0.25 mL for 24-well except for 96 well, in which 100 μl should be used. The change of transduction medium is often unnecessary with our pre-packaged lentiviral particles.  Simply culture cells for 3-4 days before analysis. 

 

The virus-containing media can be changed in as short as 4 hours after transduction if toxicity of the lentiviral transduction is a concern. Normally reverse transcription and genome integration of the lentivector takes place within 24-36 hours. With our ready-to-use, prepackaged lentiviral particles, the change of media is often unnecessary. The transduction process can be ongoing for 2 - 6 days without significant impact on cell growth/viability. The transduction process can also be repeated if desired. For a lentivector with a fluorescent reporter (such as GFP), FACS can be used to enrich for cells that express GFP. If it contains a drug selectable marker, follow the protocol for the particular drug. For example, puromycin selection is usually carried out at 1-10 μg/mL, depending on the target cells’ sensitivity

 

 

Important Safety Information

With the safety features in place, our lentiviral vectors and viral particles can be employed in standard Biosafety Level 2 tissue culture facilities and should be treated with the same level of caution as any other potentially infectious agent. Any investigator who purchases our lentiviral/retroviral products & services is responsible for following Biosafety Level 2 requirements on the handling of viral particles. For more information on Biosafety Level 2 agents and practices, please refer to NIH’s “Biosafety Considerations for Research with Lentiviral Vectors”.

 

Storage

 

The product is shipped at 4°C for immediate use.  Upon receipt, centrifuge the vial briefly before opening.  Store at –80°C or lower and the product is stable for 3 months.  Avoid repeated freeze-thaw cycles.

 

 

The product should be employed in a Biosafety Level 2 tissue culture facility.