PD-L1 (programmed cell death 1 ligand 1) or CD274 is a 290-amino acid single pass type I transmembrane protein of the Ig (immunoglobulin) superfamily.  It contains one Ig V-like and one Ig C-like domains in the extracellular region, and a 30-amino acid cytoplasmic tail. It was originally cloned as a homolog of B7 (termed B7-H1). It is 20% and 15% identical to B7-1 (CD80) and B7-2 (CD86), respectively.  It was also cloned as a ligand (termed PDCD1L1 or PD-L1) that binds to PD-1 (CD279) and B7-1 (CD80), but not to other B7 family members, such as CTLA4 (CD152), CD28, or ICOS (CD278).  PD-L1 or CD274 is involved in the T cell costimulatory signal, essential for T-cell proliferation and production of IL10 and IFNγ. Interaction with PD-1, which has a cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM), inhibits T-cell proliferation and cytokine production.  PD-L1 is up-regulated on T- and B-cells, dendritic cells, keratinocytes and monocytes after LPS and IFNγ activation or by surface Ig cross-linking. It is expressed in many types of freshly isolated human cancers but not in most normal tissues.  Blockade of PD-L1 upregulates IL12 expression and enhances antitumor immunity in mice bearing ovarian tumors.  Therefore, PD-L1 has been proposed as a target for cancer immunotherapy through pre-activated T cells that could be enhanced by blockade of PD-L1-induced inhibitory signaling. 

PD-L1 (programmed cell death 1 ligand 1) or CD274 is a 290-amino acid single pass type I transmembrane protein of the Ig (immunoglobulin) superfamily.  It contains one Ig V-like and one Ig C-like domains in the extracellular region, and a 30-amino acid cytoplasmic tail. It was originally cloned as a homolog of B7 (termed B7-H1). It is 20% and 15% identical to B7-1 (CD80) and B7-2 (CD86), respectively.  It was also cloned as a ligand (termed PDCD1L1 or PD-L1) that binds to PD-1 (CD279) and B7-1 (CD80), but not to other B7 family members, such as CTLA4 (CD152), CD28, or ICOS (CD278).  PD-L1 or CD274 is involved in the T cell costimulatory signal, essential for T-cell proliferation and production of IL10 and IFNγ. Interaction with PD-1, which has a cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM), inhibits T-cell proliferation and cytokine production.  PD-L1 is up-regulated on T- and B-cells, dendritic cells, keratinocytes and monocytes after LPS and IFNγ activation or by surface Ig cross-linking. It is expressed in many types of freshly isolated human cancers but not in most normal tissues.  Blockade of PD-L1 upregulates IL12 expression and enhances antitumor immunity in mice bearing ovarian tumors.  Therefore, PD-L1 has been proposed as a target for cancer immunotherapy through pre-activated T cells that could be enhanced by blockade of PD-L1-induced inhibitory signaling. 

 

Product Details

 

Gene Symbol: PD-L1; CD274; B7-H1; B7H1;  PDL1;  PDCD1L1; PDCD1LG1

 

NCBI Gene ID: 29126

 

Uniprot Entry: Q9NZQ7

 

Construct Details: Full length human PD-L1 or CD274 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Cell surface PD-L1 expression can be monitored by anti-PD-L1 antibody (SKU#: MAB0199).

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 873 (bp)

 

Gene Insert Sequence:  

ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCT

ATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAA

TTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGC

TACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCA

GGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCAT

ACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTAC

CCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGA

GGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGAT

TAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCAC

TTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGAT

GGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Nat. Med. 5:1365-1369, 1999

2. J. Exp. Med. 192:1027-1034, 2000

3. Nature Med. 8: 793-800, 2002

4. Nature Med. 9: 562-567, 2003

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0746-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.