There are 3 classes of receptors for the Fc region of IgG (FcγRs): FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), each with multiple isoforms.  All these receptors are members of the Ig superfamily (IgSF) and they play important roles in the activation or inhibition of immune responses. FcγRI is a high-affinity receptor for IgG while both FcγRII and FcγRIII are low-affinity receptors that bind IgG in the form of immune complexes.  There are 3 genes for human FcγRII (CD32A, B, & C) that encodes single pass type I transmembrane proteins. The extracellular domain (ECD) of 3 human FcγRIIs shares ~90% amino acid sequence homology containing 2 Ig-like C2-type motifs.  CD32A and CD32C contain immunoreceptor tyrosine-based activation motifs (ITAMs) while CD32B has an inhibitory motif (ITIM) in their cytoplasmic regions. Together they act as an activating or inhibiting receptor pair to regulate immune responses. CD32A is expressed on many immune cells including macrophage, neutrophil, eosinophils, platelets, dendritic cells and Langerhan cells. Signaling through CD32A results in the initiation of inflammatory responses such as cytolysis, phagocytosis, degranulation and cytokine production that can be modulated by signals from the inhibitory receptors. The strength of the signal is dependent on the ratio of expression of the activating and inhibitory receptors. Besides Fc, CD32A also binds C-reactive protein (CRP).  Two allelic variants (R167 and H167) of CD32A differ in their ability to bind human IgG2 or CRP.

There are 3 classes of receptors for the Fc region of IgG (FcγRs): FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), each with multiple isoforms.  All these receptors are members of the Ig superfamily (IgSF) and they play important roles in the activation or inhibition of immune responses. FcγRI is a high-affinity receptor for IgG while both FcγRII and FcγRIII are low-affinity receptors that bind IgG in the form of immune complexes.  There are 3 genes for human FcγRII (CD32A, B, & C) that encodes single pass type I transmembrane proteins. The extracellular domain (ECD) of 3 human FcγRIIs shares ~90% amino acid sequence homology containing 2 Ig-like C2-type motifs.  CD32A and CD32C contain immunoreceptor tyrosine-based activation motifs (ITAMs) while CD32B has an inhibitory motif (ITIM) in their cytoplasmic regions. Together they act as an activating or inhibiting receptor pair to regulate immune responses. CD32A is expressed on many immune cells including macrophage, neutrophil, eosinophils, platelets, dendritic cells and Langerhan cells. Signaling through CD32A results in the initiation of inflammatory responses such as cytolysis, phagocytosis, degranulation and cytokine production that can be modulated by signals from the inhibitory receptors. The strength of the signal is dependent on the ratio of expression of the activating and inhibitory receptors. Besides Fc, CD32A also binds C-reactive protein (CRP).  Two allelic variants (R167 and H167) of CD32A differ in their ability to bind human IgG2 or CRP.

 

Product Details

 

Gene Symbol: CD32A; FCGR2A; FCG2; FcGR; CD32; CDw32; FCGR2; IGFR2; FCGR2A1

 

NCBI Gene ID: 2212

 

Uniprot Entry: P12318

 

Construct Details: Full length human CD32A/FCGR2 gene (encoding UniProt #P12318) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 954 (bp)

 

Gene Insert Sequence:  

ATGACTATGGAGACCCAAATGTCTCAGAATGTATGTCCCAGAAACCTGTGGCTGCTTCAACCATTGACAG

TTTTGCTGCTGCTGGCTTCTGCAGACAGTCAAGCTGCAGCTCCCCCAAAGGCTGTGCTGAAACTTGAGCC

CCCGTGGATCAACGTGCTCCAGGAGGACTCTGTGACTCTGACATGCCAGGGGGCTCGCAGCCCTGAGAGC

GACTCCATTCAGTGGTTCCACAATGGGAATCTCATTCCCACCCACACGCAGCCCAGCTACAGGTTCAAGG

CCAACAACAATGACAGCGGGGAGTACACGTGCCAGACTGGCCAGACCAGCCTCAGCGACCCTGTGCATCT

GACTGTGCTTTCCGAATGGCTGGTGCTCCAGACCCCTCACCTGGAGTTCCAGGAGGGAGAAACCATCATG

CTGAGGTGCCACAGCTGGAAGGACAAGCCTCTGGTCAAGGTCACATTCTTCCAGAATGGAAAATCCCAGA

AATTCTCCCATTTGGATCCCACCTTCTCCATCCCACAAGCAAACCACAGTCACAGTGGTGATTACCACTG

CACAGGAAACATAGGCTACACGCTGTTCTCATCCAAGCCTGTGACCATCACTGTCCAAGTGCCCAGCATG

GGCAGCTCTTCACCAATGGGGATCATTGTGGCTGTGGTCATTGCGACTGCTGTAGCAGCCATTGTTGCTG

CTGTAGTGGCCTTGATCTACTGCAGGAAAAAGCGGATTTCAGCCAATTCCACTGATCCTGTGAAGGCTGC

CCAATTTGAGCCACCTGGACGTCAAATGATTGCCATCAGAAAGAGACAACTTGAAGAAACCAACAATGAC

TATGAAACAGCTGACGGCGGCTACATGACTCTGAACCCCAGGGCACCTACTGACGATGATAAAAACATCT

ACCTGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Immunol. Today 14:215 (1993)

2. J. Immunol. 157:1184 (1996)

3. Annu. Rev. Immunol.19:275 (2001)

4. J. Immunol. 168:1413 (2002)

5. Nature Rev. Immunol. 2:580 (2002)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2124-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.