Fas, also known as APO-1 and CD95, is a single-pass, type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF6). Fas is highly expressed on epithelial cells, hepatocytes, activated mature lymphocytes, virus­transformed lymphocytes and tumor cells. Fas contains an extracellular domain (ECD) with three cysteine­rich repeats that mediates the interaction with Fas ligand (FasL) or TNFSF6, a type II transmembrane protein expressed on activated T cells, NK cells and other immune cells.  The cytoplasmic region of Fas contains a death domain (DD), which is required for transducing apoptotic signals. Fas is also involved in the activation of NF-κB, ERK, JNK, and alternate pathways for T cell-mediated cytotoxicity. Fas is implicated in the pathogenesis of various malignancies and diseases of the immune system.  Multiple Fas isoforms are derived from alternative splicing. For example, a soluble form that lacks the transmembrane domain is secreted by resting lymphocytes.  Alternate shorter isoforms that lack the DD and have substitutions for cysteine-rich repeats are less prominently expressed. These isoforms can block the extrinsic apoptosis pathway induced by FasL. Fas is an essential mediator in the activation-induced death of T cells that terminates the immune reaction.  In immune-privileged tissues, infiltrating Fas-bearing lymphocytes and inflammatory cells are killed by FasL engagement. Both humans and animals with genetic defects in Fas accumulate abnormal lymphocytes and develop systemic autoimmunity. Mutations in Fas are associated with autoimmune lymphoproliferative syndrome 1A (ALPS1A).

Fas, also known as APO-1 and CD95, is a single-pass, type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF6). Fas is highly expressed on epithelial cells, hepatocytes, activated mature lymphocytes, virus­transformed lymphocytes and tumor cells. Fas contains an extracellular domain (ECD) with three cysteine­rich repeats that mediates the interaction with Fas ligand (FasL) or TNFSF6, a type II transmembrane protein expressed on activated T cells, NK cells and other immune cells.  The cytoplasmic region of Fas contains a death domain (DD), which is required for transducing apoptotic signals. Fas is also involved in the activation of NF-κB, ERK, JNK, and alternate pathways for T cell-mediated cytotoxicity. Fas is implicated in the pathogenesis of various malignancies and diseases of the immune system.  Multiple Fas isoforms are derived from alternative splicing. For example, a soluble form that lacks the transmembrane domain is secreted by resting lymphocytes.  Alternate shorter isoforms that lack the DD and have substitutions for cysteine-rich repeats are less prominently expressed. These isoforms can block the extrinsic apoptosis pathway induced by FasL. Fas is an essential mediator in the activation-induced death of T cells that terminates the immune reaction.  In immune-privileged tissues, infiltrating Fas-bearing lymphocytes and inflammatory cells are killed by FasL engagement. Both humans and animals with genetic defects in Fas accumulate abnormal lymphocytes and develop systemic autoimmunity. Mutations in Fas are associated with autoimmune lymphoproliferative syndrome 1A (ALPS1A).

  

Product Details

 

Gene Symbol: TNFRSF6; CD95; APT1; FAS1; APO-1; FASTM; ALPS1A

  

NCBI Gene ID: 355

 

Uniprot Entry: P25445

 

Construct Details: Full length human Fas/CD95 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCCAAAAGTGTTAATGCCCAAGT

GACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATC

ATGATGGCCAATTCTGCCATAAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA

GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAATGCAGAAGATGTAGATTGTG

TGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACCCGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTT

TTTGTAACTCTACTGTATGTGAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC

AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTTCTTTTGCCAATTCCACTAAT

TGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGAAAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAA

CTTTAAATCCTGAAACAGTGGCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG

ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGATGAGATCAAGAATGACAATGT

CCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAATTGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACAT

TGATTAAAGATCTCAAAAAAGCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT

GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTAG

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

1. Cell. 75: 1169 (1993).

2. Science 263:1759 (1994).

3. J. Immunol. 154: 2706 (1995).

4. Nature. 373: 441 (1995).

5. J. Immunol. 156:4622 (1996).

6. Immunol. Rev. 213:228 (2006).

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0107-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.